Additional file 3 of Clinical validation of a novel quantitative assay for the detection of MGMT methylation in glioblastoma patients
- Resource Type
- Authors
- Rocio Rosas-Alonso; Colmenarejo-Fernandez, Julian; Pernia, Olga; Rodriguez-Antolín, Carlos; Esteban, Isabel; Ghanem, Ismael; Sanchez-Cabrero, Dario; Losantos-Garcia, Itsaso; Palacios-Zambrano, Sara; Moreno-Bueno, Gema; Castro, Javier De; Martinez-Marin, Virginia; Ibanez-De-Caceres, Inmaculada
- Source
- Subject
- neoplasms
digestive system diseases
- Language
Additional file 3: Supplementary Figure 3. Agarose gel with the MGMT promoter amplification of five samples with discrepancies between MSP and dp_qMSP. It has been performed in a collaborative center (MD Anderson Madrid) with an alternative methodology using EpiTec for DNA modification and using the next primers and conditions for PCR amplification: MGMT-M-F TTTCGACGTTCGTAGGTTTTCGC and MGMT-M-R GCACTCTTCCGAAAACGAAAC MGMT-U-F TTTGTGTTTTGATGTTTGTAGGTTTTTGT and MGMT- U-R AACTCCACACTCTTCCAAAAACAAAACA For both reactions the PCR settings are 58°C and 35 cycles. The arrows indicate a slightly amplification at the methylation reaction in samples 1, 78 and 100. For none of those patients these results were considered positive for clinical diagnosis.